ID: 1029652515_1029652524

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029652515 1029652524
Species Human (GRCh38) Human (GRCh38)
Location 7:101903199-101903221 7:101903239-101903261
Sequence CCTGGTATGGGGGAACACAGGAG TACACAAGGCGGGTGGTGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 266} {0: 1, 1: 0, 2: 1, 3: 18, 4: 126}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!