ID: 1029665429_1029665439

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1029665429 1029665439
Species Human (GRCh38) Human (GRCh38)
Location 7:101992194-101992216 7:101992216-101992238
Sequence CCTACTGAGCTCCTTAAAGCACA AGGGGAAAGTGGGACGGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 12, 4: 167} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!