ID: 1029669549_1029669555

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1029669549 1029669555
Species Human (GRCh38) Human (GRCh38)
Location 7:102019689-102019711 7:102019732-102019754
Sequence CCCGTGGTGGAGTTGTACCACGT TCAGCATTGGAGACTCTGCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!