ID: 1029669550_1029669553

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1029669550 1029669553
Species Human (GRCh38) Human (GRCh38)
Location 7:102019690-102019712 7:102019719-102019741
Sequence CCGTGGTGGAGTTGTACCACGTA AAAAGCCACAGCATCAGCATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 341} {0: 1, 1: 2, 2: 1, 3: 19, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!