ID: 1029675254_1029675263

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1029675254 1029675263
Species Human (GRCh38) Human (GRCh38)
Location 7:102064294-102064316 7:102064318-102064340
Sequence CCCACCTTGGCCTCCCAAAGTGC GGGATTACAGGCATGAGCAACGG
Strand - +
Off-target summary No data {0: 14, 1: 1919, 2: 4906, 3: 5219, 4: 3580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!