ID: 1029675255_1029675269

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1029675255 1029675269
Species Human (GRCh38) Human (GRCh38)
Location 7:102064295-102064317 7:102064348-102064370
Sequence CCACCTTGGCCTCCCAAAGTGCT TCTAAATGGTTTTAAGGGCACGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 11, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!