ID: 1029675257_1029675263

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1029675257 1029675263
Species Human (GRCh38) Human (GRCh38)
Location 7:102064298-102064320 7:102064318-102064340
Sequence CCTTGGCCTCCCAAAGTGCTGGG GGGATTACAGGCATGAGCAACGG
Strand - +
Off-target summary {0: 79234, 1: 201556, 2: 232767, 3: 156913, 4: 93134} {0: 14, 1: 1919, 2: 4906, 3: 5219, 4: 3580}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!