|
Left Crispr |
Right Crispr |
Crispr ID |
1029675257 |
1029675263 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
7:102064298-102064320
|
7:102064318-102064340
|
Sequence |
CCTTGGCCTCCCAAAGTGCTGGG |
GGGATTACAGGCATGAGCAACGG |
Strand |
- |
+ |
Off-target summary |
{0: 79234, 1: 201556, 2: 232767, 3: 156913, 4: 93134} |
{0: 14, 1: 1919, 2: 4906, 3: 5219, 4: 3580} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|