ID: 1029675284_1029675294

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1029675284 1029675294
Species Human (GRCh38) Human (GRCh38)
Location 7:102064490-102064512 7:102064535-102064557
Sequence CCTCCCCTTCTCAGAGGGAGCTG CCTCCAAGGCATGCAGTGGATGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 6, 3: 48, 4: 790} {0: 3, 1: 0, 2: 2, 3: 15, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!