ID: 1029679189_1029679199

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1029679189 1029679199
Species Human (GRCh38) Human (GRCh38)
Location 7:102096261-102096283 7:102096308-102096330
Sequence CCTGCGGCCGCTAACCCCTGACT AGGAGGATCGTAATGGAAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!