ID: 1029686698_1029686709

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1029686698 1029686709
Species Human (GRCh38) Human (GRCh38)
Location 7:102153407-102153429 7:102153449-102153471
Sequence CCCCAGGCAGCCACGCCTCCAGC AAGATCAGGGAGCTGCACCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 13, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!