ID: 1029687706_1029687708

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029687706 1029687708
Species Human (GRCh38) Human (GRCh38)
Location 7:102160140-102160162 7:102160180-102160202
Sequence CCATACTCCAGCTTGGATGACAG AAAAAAAAAAAAGCAGTTACTGG
Strand - +
Off-target summary No data {0: 2, 1: 13, 2: 263, 3: 2354, 4: 13164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!