ID: 1029690513_1029690519

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1029690513 1029690519
Species Human (GRCh38) Human (GRCh38)
Location 7:102178264-102178286 7:102178286-102178308
Sequence CCAGTGAATGAATCGAGGTGGCA AGCTAACCACAGGGGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74} {0: 1, 1: 0, 2: 0, 3: 12, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!