ID: 1029691564_1029691572 |
View in Genome Browser |
Spacer: 17 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1029691564 | 1029691572 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:102185534-102185556 | 7:102185574-102185596 |
| Sequence | CCCAGCCTCCTGAGTAGCTGGGA | CACACCCAGCTAATGTTTTGGGG |
| Strand | - | + |
| Off-target summary | {0: 1407, 1: 2931, 2: 4100, 3: 3640, 4: 3218} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||