ID: 1029695924_1029695927

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1029695924 1029695927
Species Human (GRCh38) Human (GRCh38)
Location 7:102213188-102213210 7:102213202-102213224
Sequence CCTTTGGTGGAGATTGTCCCTTG TGTCCCTTGCAGATGGTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 97} {0: 1, 1: 0, 2: 0, 3: 21, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!