ID: 1029696224_1029696235

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1029696224 1029696235
Species Human (GRCh38) Human (GRCh38)
Location 7:102215022-102215044 7:102215059-102215081
Sequence CCTTAGCAGCACCTCTGAACCCA GAGGACACCCGGGCCCCAGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 54, 4: 312}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!