ID: 1029724163_1029724170

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1029724163 1029724170
Species Human (GRCh38) Human (GRCh38)
Location 7:102391091-102391113 7:102391134-102391156
Sequence CCCTGTCCCATCTGTGTGAGTCA CAGACCCAGGGCTAGACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 120, 4: 528} {0: 1, 1: 0, 2: 4, 3: 21, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!