ID: 1029736844_1029736853

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1029736844 1029736853
Species Human (GRCh38) Human (GRCh38)
Location 7:102469811-102469833 7:102469841-102469863
Sequence CCGCCTGCTGGCCGGCTGCGAGG CTGCTGCTGGGACGTGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 9, 4: 190} {0: 1, 1: 0, 2: 0, 3: 19, 4: 223}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!