ID: 1029741283_1029741293

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1029741283 1029741293
Species Human (GRCh38) Human (GRCh38)
Location 7:102493111-102493133 7:102493164-102493186
Sequence CCCACCTTGGAGCTGGGCGTCTT GAAGTAGAGCTTCTTGAAGGAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 9, 4: 100} {0: 4, 1: 0, 2: 0, 3: 14, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!