ID: 1029753108_1029753118

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1029753108 1029753118
Species Human (GRCh38) Human (GRCh38)
Location 7:102555438-102555460 7:102555489-102555511
Sequence CCCTGTCTCTTCTAGAAGCACAA TGTAATCCCAGCTACTTGGGAGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!