ID: 1029759257_1029759271

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1029759257 1029759271
Species Human (GRCh38) Human (GRCh38)
Location 7:102592233-102592255 7:102592274-102592296
Sequence CCCACTTGCCGGCCTCTCAGAGC TCCTTACCCACCTTGGAGCTGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 9, 4: 122} {0: 4, 1: 0, 2: 0, 3: 9, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!