ID: 1029766131_1029766144

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1029766131 1029766144
Species Human (GRCh38) Human (GRCh38)
Location 7:102627465-102627487 7:102627505-102627527
Sequence CCCTGAGAGGTCACTTCCTGGAC GCCCACAGTGGGAAGAGAAGGGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 8, 3: 46, 4: 405}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!