ID: 1029771059_1029771064

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1029771059 1029771064
Species Human (GRCh38) Human (GRCh38)
Location 7:102654521-102654543 7:102654544-102654566
Sequence CCCTGTCTCTTCTAGAAGCACAA AAATGAGCTGGGCGTTCTGGTGG
Strand - +
Off-target summary {0: 8, 1: 0, 2: 152, 3: 5593, 4: 80206} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!