|
Left Crispr |
Right Crispr |
| Crispr ID |
1029797214 |
1029797225 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
7:102908923-102908945
|
7:102908965-102908987
|
| Sequence |
CCCTGGGGCTCTACAATCAGCAG |
CTGTGTCCTCCTCTTCAGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 54, 1: 179, 2: 331, 3: 392, 4: 456} |
{0: 1, 1: 10, 2: 47, 3: 163, 4: 492} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|