ID: 1029810049_1029810056 |
View in Genome Browser |
Spacer: -5 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1029810049 | 1029810056 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:103038146-103038168 | 7:103038164-103038186 |
| Sequence | CCTCCCTCCCATGCCTGGCTCGG | CTCGGTGAGTCCCACACCCATGG |
| Strand | - | + |
| Off-target summary | No data | {0: 3, 1: 21, 2: 119, 3: 567, 4: 2098} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||