ID: 1029813082_1029813087

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1029813082 1029813087
Species Human (GRCh38) Human (GRCh38)
Location 7:103068925-103068947 7:103068946-103068968
Sequence CCAGATTTTAAAGTTGAGGGCCC CCACGGCCACCACGCCATCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 132, 4: 1525}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!