ID: 1029818287_1029818290

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1029818287 1029818290
Species Human (GRCh38) Human (GRCh38)
Location 7:103119827-103119849 7:103119862-103119884
Sequence CCAACTCAATCACATTCTCACAG ATCCAGTCAAGGAGACCCAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 233} {0: 1, 1: 0, 2: 2, 3: 12, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!