ID: 1029831562_1029831565

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1029831562 1029831565
Species Human (GRCh38) Human (GRCh38)
Location 7:103265855-103265877 7:103265868-103265890
Sequence CCTGGGATACAGCTAGGAAATAC TAGGAAATACATAATGGGCATGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 3, 3: 18, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!