ID: 1029835135_1029835143

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1029835135 1029835143
Species Human (GRCh38) Human (GRCh38)
Location 7:103301470-103301492 7:103301514-103301536
Sequence CCTAGTTCCTTCCTTTATTTACA AAGGAGAAACAGAAAAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 462} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!