ID: 1029847863_1029847867

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1029847863 1029847867
Species Human (GRCh38) Human (GRCh38)
Location 7:103431473-103431495 7:103431507-103431529
Sequence CCACCACAGCTGGCTAATTTTTA ATAGAGAAAGGGTCTCATTATGG
Strand - +
Off-target summary {0: 53, 1: 2568, 2: 33394, 3: 91381, 4: 180790} {0: 1, 1: 0, 2: 14, 3: 79, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!