ID: 1029879567_1029879569

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1029879567 1029879569
Species Human (GRCh38) Human (GRCh38)
Location 7:103793475-103793497 7:103793522-103793544
Sequence CCATAATTAGACTGACTCTTCTC TGCCATGTTGCTAAGCATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!