ID: 1029887505_1029887510

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1029887505 1029887510
Species Human (GRCh38) Human (GRCh38)
Location 7:103888688-103888710 7:103888720-103888742
Sequence CCCCATGATGCCACAGCTTGGTA TGTATTCTCCTAACAGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107} {0: 1, 1: 0, 2: 2, 3: 9, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!