ID: 1029906767_1029906773

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1029906767 1029906773
Species Human (GRCh38) Human (GRCh38)
Location 7:104100645-104100667 7:104100669-104100691
Sequence CCTGGTCATCTCCTTCACTAGAG AAGCACCTACAGCCAAGGGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!