ID: 1029909488_1029909490

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1029909488 1029909490
Species Human (GRCh38) Human (GRCh38)
Location 7:104130313-104130335 7:104130330-104130352
Sequence CCTTTCCACTGTAGTCTCTATAT CTATATCCTCTATCTCTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!