ID: 1029915739_1029915741

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1029915739 1029915741
Species Human (GRCh38) Human (GRCh38)
Location 7:104208041-104208063 7:104208077-104208099
Sequence CCGGGCTGCGGCGTGACGGCAGC GTCGCCGCCGCTCTAGTCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116} {0: 1, 1: 0, 2: 0, 3: 2, 4: 27}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!