ID: 1029956680_1029956686

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1029956680 1029956686
Species Human (GRCh38) Human (GRCh38)
Location 7:104647747-104647769 7:104647772-104647794
Sequence CCTGCCATCTCTTTTATGTTCCT AGGAAGAAGGAGAAAGAGGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!