ID: 1029966397_1029966402

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1029966397 1029966402
Species Human (GRCh38) Human (GRCh38)
Location 7:104745245-104745267 7:104745270-104745292
Sequence CCTTCCTCTTTCTCCTTCTTCCT AGGAACATAAAAGAGATAGCAGG
Strand - +
Off-target summary {0: 2, 1: 10, 2: 168, 3: 1248, 4: 6461} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!