ID: 1029969603_1029969612

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1029969603 1029969612
Species Human (GRCh38) Human (GRCh38)
Location 7:104776447-104776469 7:104776490-104776512
Sequence CCCCCCACAGCCAGCTTCTCCTT ATCAGAATCACCTGAAGTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 34, 4: 282}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!