ID: 1029986683_1029986687

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1029986683 1029986687
Species Human (GRCh38) Human (GRCh38)
Location 7:104929152-104929174 7:104929166-104929188
Sequence CCCCAACCAGTGATGTCTCCTTG GTCTCCTTGAAACTCCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!