ID: 1030008512_1030008521

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1030008512 1030008521
Species Human (GRCh38) Human (GRCh38)
Location 7:105142007-105142029 7:105142043-105142065
Sequence CCTTTTGGCAAATCCCCAGTACT GTTCTGCTTCTGTCATGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 1055} {0: 1, 1: 0, 2: 1, 3: 31, 4: 339}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!