ID: 1030045164_1030045166

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1030045164 1030045166
Species Human (GRCh38) Human (GRCh38)
Location 7:105488837-105488859 7:105488859-105488881
Sequence CCTAGTTCTTTCTGTGTTGAAAA ACAAAATAGGCAGAGCCCAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 96, 4: 1131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!