ID: 1030050581_1030050588

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1030050581 1030050588
Species Human (GRCh38) Human (GRCh38)
Location 7:105533436-105533458 7:105533485-105533507
Sequence CCATTTTACTTTGATGGCAGGTT CCTTTGAAGTGACATTTTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 742} {0: 1, 1: 0, 2: 0, 3: 21, 4: 306}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!