ID: 1030065460_1030065473

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1030065460 1030065473
Species Human (GRCh38) Human (GRCh38)
Location 7:105655780-105655802 7:105655831-105655853
Sequence CCTCAGCCCCAGTTGCTCCGGGA GAGAGGAGCCCCGCCTACCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 222} {0: 1, 1: 0, 2: 1, 3: 8, 4: 150}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!