ID: 1030068257_1030068263

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1030068257 1030068263
Species Human (GRCh38) Human (GRCh38)
Location 7:105677029-105677051 7:105677043-105677065
Sequence CCAGGCCCCGTGGAGGGAGGATC GGGAGGATCCTGGCTGCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 205} {0: 1, 1: 0, 2: 4, 3: 61, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!