ID: 1030142673_1030142681

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1030142673 1030142681
Species Human (GRCh38) Human (GRCh38)
Location 7:106320910-106320932 7:106320948-106320970
Sequence CCTCATATGGCCAGGTGGCCGGG AAGCTTCCAGAGGAAGGATCAGG
Strand - +
Off-target summary No data {0: 980, 1: 1675, 2: 2104, 3: 1348, 4: 927}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!