ID: 1030206895_1030206899

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1030206895 1030206899
Species Human (GRCh38) Human (GRCh38)
Location 7:106959941-106959963 7:106959975-106959997
Sequence CCAGCTCCAGCCTCTAGAGTGGC GCACCAGTGCGGTGTGCCTTAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!