ID: 1030225597_1030225604

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1030225597 1030225604
Species Human (GRCh38) Human (GRCh38)
Location 7:107146829-107146851 7:107146874-107146896
Sequence CCAGAGTGTGGTCCCCTGAACAC CTTTTTAGAAATGCCCATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 136} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!