ID: 1030272565_1030272568 |
View in Genome Browser |
Spacer: -3 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1030272565 | 1030272568 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 7:107686067-107686089 | 7:107686087-107686109 |
| Sequence | CCTGGAATGCAGTGGCATGATCT | TCTCTGTGGTGTGTGTGTGTGGG |
| Strand | - | + |
| Off-target summary | {0: 19, 1: 436, 2: 1264, 3: 2376, 4: 3117} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||