ID: 1030323231_1030323242

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1030323231 1030323242
Species Human (GRCh38) Human (GRCh38)
Location 7:108192091-108192113 7:108192125-108192147
Sequence CCTCTAGAGCACGGGTCCCCAAA GAACTGGGTACTGTCCTGTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 19, 3: 101, 4: 367} {0: 1, 1: 0, 2: 1, 3: 9, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!