ID: 1030368750_1030368757

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1030368750 1030368757
Species Human (GRCh38) Human (GRCh38)
Location 7:108673998-108674020 7:108674046-108674068
Sequence CCTGCCATCTTCTGCAGAAAACT GGCCTGTTACTGGGCTTTGGTGG
Strand - +
Off-target summary No data {0: 144, 1: 161, 2: 86, 3: 68, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!