ID: 1030408898_1030408902

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1030408898 1030408902
Species Human (GRCh38) Human (GRCh38)
Location 7:109149243-109149265 7:109149286-109149308
Sequence CCCTTTTTCCTCATTCTCACCAG TTGATAAAATTCATTCTAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 7, 2: 126, 3: 827, 4: 3255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!